View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_88 (Length: 249)
Name: NF10129_low_88
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_88 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 35235678 - 35235438
Alignment:
| Q |
9 |
acgtaggctgttcgacgagagtgacacttctaaggttattgagggaaataacggcaatgttacaatgagataggggtgacaatgactgtcacataatatt |
108 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235678 |
acgtaggctgttcgacgagagtgaaagttctaaggttattgagggaaataacggcaatgttacaatgagataggggtgacaatgactgtcacataatatt |
35235579 |
T |
 |
| Q |
109 |
tatgatggcgttgttacttgtcacacaaaaataggggctagtccaaaaacaacatcgttcaaagtacaaaggcagcttttgttatcataagaaacttcgt |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35235578 |
tatgatggcgttgttacttgttacacaaaaataggggctagtccaaaaacaacatcgttcaaagtacaaaggcaacttttgttatcataagaaacttcgt |
35235479 |
T |
 |
| Q |
209 |
tttgtccaatatcttgataatgtcaaatagatatgggactt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235478 |
tttgtccaatatcttgataatgtcaaatagatatgggactt |
35235438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University