View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_91 (Length: 243)
Name: NF10129_low_91
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_91 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 31831190 - 31830991
Alignment:
| Q |
1 |
tcaatagtatactaggatattaaatagtatgctgctagggaaaatgggtttggttttggttgttttagaggccaatgaagggcatattttaaaatggtcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31831190 |
tcaatagtatactaggatattaaatagtatgctgctagggaaaatgggtttggtt------gttttagaggccaatgaagggcatattttaaaatggtcc |
31831097 |
T |
|
| Q |
101 |
ttcaatttatggctctttggttattgtggtgttttggtttttgtac--ttgagatgnnnnnnngaccattctgctgttaatatagcagaaaggaactttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31831096 |
ttcaatttatggctctttggttattgtggtgttttggtttttgtacttttgagatg-ttttttgaccattctgctgttaatatagcagaagggaactttt |
31830998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University