View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_92 (Length: 242)
Name: NF10129_low_92
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 38 - 189
Target Start/End: Complemental strand, 38064332 - 38064191
Alignment:
| Q |
38 |
tatacgacatgaaaatcagtgagactcatttatcatcattcatcactgccacaatcacatgtcaacattattagctctcnnnnnnnnnnnnnnnnnnncc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
38064332 |
tatacgacatgaaaatcagtgagactcatttatca----------ctgccacaatcacatgtcaacattattagctctcaaaagcaaaaaacaaaaaacc |
38064243 |
T |
|
| Q |
138 |
acagcgtgaaagtgtgcactccactgaatagtatgttgtcacctacccaaat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38064242 |
acagcgtgaaagtgtgcactccactgaatagtatgttgtcacctacccaaat |
38064191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 38062793 - 38062746
Alignment:
| Q |
182 |
acccaaatcaaaacctaatcacaaatgatttggttacaactaagtttc |
229 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38062793 |
acccaaattaaaacctaatcacaaatgatttggttacaactaagtttc |
38062746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University