View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_98 (Length: 240)
Name: NF10129_low_98
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32482408 - 32482628
Alignment:
| Q |
1 |
tttctggagacgcacacaaaacacggtatcccataaaccatttttcacaaatcccaattaattctctctcaactgtttcttgatttctcatgttctttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482408 |
tttctggagacgcacacaaaacacggtatcccataaaccatttttcacaaatcccaattaattctctctcaactgtttcttgatttctcatgttctttgt |
32482507 |
T |
 |
| Q |
101 |
accnnnnnnnnnnnncctatttaggtttttgatatggaaattgagacacaattaaagaaactattgttgttagggttaaggnnnnnnncttcaaagaaat |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
32482508 |
accaaaaacaaaaaacctatttaggtttttgatatggaaattgagacacaattaaagaaagtattgttgttagggttaaggtttttttcttcaaagaaat |
32482607 |
T |
 |
| Q |
201 |
ggctggtttgttctcattagg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32482608 |
ggctggtttgttctcattagg |
32482628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University