View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1012_low_1 (Length: 383)
Name: NF1012_low_1
Description: NF1012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1012_low_1 |
 | |
|
| [»] scaffold0754 (1 HSPs) |
| | |
|
| [»] scaffold0563 (2 HSPs) |
| | |
|
| [»] scaffold0543 (1 HSPs) |
| | |
|
| [»] scaffold0492 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 4e-88; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 53 - 304
Target Start/End: Complemental strand, 38849024 - 38848772
Alignment:
| Q |
53 |
gatggaacatggttgatgcttaagaggttggactgtaggatacactatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
|||||||||||| || ||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | || ||||| |
|
|
| T |
38849024 |
gatggaacatggctgtgtcttaacaggttgggctgtaggatacactatgctggcctgcccgctccaagttgagagttgggccatgggatcttggcgaagg |
38848925 |
T |
|
| Q |
152 |
ctcaggtctcctggtcattagaatggagggatccgcatgaggttggtttcatagagcagggaacacttccttctcttgacaatggagggatcacatgctg |
251 |
Q |
| |
|
| ||| |||||||||| |||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
38848924 |
cacagatctcctggtccctagaatggagggatccgcatgaggctggtttcacagagcagtgaacacttccttctcttgacagtggagggatcacaggctg |
38848825 |
T |
|
| Q |
252 |
ctgtattctcagcccatatggcctggtgagcctagtccattgaaccatcattt |
304 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38848824 |
ctgtattctcagcccgtatggcctggtgagcctagcccattgaaccatcattt |
38848772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 53 - 304
Target Start/End: Complemental strand, 39310756 - 39310505
Alignment:
| Q |
53 |
gatggaacatggttgatgcttaagaggttggactgtaggatacactatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||||| ||| ||||| ||||||| ||||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39310756 |
gatggaacatgattgtgtcttaacaggttgggctgtagggtacattatgctggcctgcccactccaagttgagagttgggccatgggatttgggcgaagg |
39310657 |
T |
|
| Q |
152 |
ctcaggtctcctggtcattagaatggagggatccgcatgaggttggtttcatagagcagggaacacttccttctcttgacaatggagggatcacatgctg |
251 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
39310656 |
ctcagatctcctggtcactagaacggagggatccgcatgaggctggtttcacagagcagtgaacacttccttctcttgacagtggagggatcacaggctg |
39310557 |
T |
|
| Q |
252 |
ctgtattctcagcccatatggcctggtgagcctagtccattgaaccatcattt |
304 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39310556 |
cagtattctcagcccatatggcctggtgagcctag-ccattgaaccatcattt |
39310505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 53 - 304
Target Start/End: Original strand, 38750078 - 38750329
Alignment:
| Q |
53 |
gatggaacatggttgatgcttaagaggttggactgtaggatacactatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
|||||||||||| || ||||| ||||||| ||||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38750078 |
gatggaacatggctgtgtcttaacaggttgggctgtagggtacattatgctggcctgcccactccaagttgagagttgggccatgggatttgggcgaagg |
38750177 |
T |
|
| Q |
152 |
ctcaggtctcctggtcattagaatggagggatccgcatgaggttggtttcatagagcagggaacacttccttctcttgacaatggagggatcacatgctg |
251 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||||||||||| |||||||| ||||||| || |||||||||||||||||| ||||||||| ||| |||| |
|
|
| T |
38750178 |
ctcagatctcctggtcactagaacggagggatccgcatgaggctggtttcacagagcagtgatcacttccttctcttgacagtggagggattacaggctg |
38750277 |
T |
|
| Q |
252 |
ctgtattctcagcccatatggcctggtgagcctagtccattgaaccatcattt |
304 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38750278 |
ctgtattctcagcccata-ggcctggtgagcctagtccattgaaccatcattt |
38750329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 53 - 301
Target Start/End: Original strand, 38807406 - 38807655
Alignment:
| Q |
53 |
gatggaacatggttgatgcttaagaggttggactgtaggatacactatgctggct-gcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
|||||||||||| || ||||| ||||||| ||||||| ||||||| ||||||| |||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38807406 |
gatggaacatggctgtgtcttaacaggttgggctgtagggtacactaagctggcttgcccactccaagttgagagttgggccatgggatttgggcgaagg |
38807505 |
T |
|
| Q |
152 |
ctcaggtctcctggtcattagaatggagggatccgcatgaggttggtttcatagagcagggaacacttccttctcttgacaatggagggatcacatgctg |
251 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||| |||||||| ||||||| |||||||||||||||| |||| ||||||||| ||| |||| |
|
|
| T |
38807506 |
ctcaggtctcctggtccctagaacggagggaaccgcatgaggctggtttcacagagcagtgaacacttccttctctcgacagtggagggattacaggctg |
38807605 |
T |
|
| Q |
252 |
ctgtattctcagcccatatggcctggtgagcctagtccattgaaccatca |
301 |
Q |
| |
|
||| |||||| | |||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38807606 |
ctgcattctcggtccatatagcctggtgagcctagcccattgaaccatca |
38807655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 78 - 301
Target Start/End: Complemental strand, 38865985 - 38865761
Alignment:
| Q |
78 |
ggttggactgtaggatacactatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaaggctcaggtctcctggtcattagaatg |
176 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
38865985 |
ggttgggctgtagggtacactatgctggcctgcccactccaagttgagagttgggccatgggatttgggcgaaggctcagatctcctggtcactagaatg |
38865886 |
T |
|
| Q |
177 |
gagggatccgcatgaggttggtttcatagagcagggaacacttccttctcttgacaatggagggatcacatgctgctgtattctcagcccatatggcctg |
276 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| ||||||||||||||||||||| ||||||||||||| ||||| ||||||| || |||||||||| |
|
|
| T |
38865885 |
gagggatccgcatgaggctggttttacagagcagtgaacacttccttctcttgacagtggagggatcacaggctgcagtattcttggcttatatggcctg |
38865786 |
T |
|
| Q |
277 |
gtgagcctagtccattgaaccatca |
301 |
Q |
| |
|
|||||||||| || |||||||||| |
|
|
| T |
38865785 |
gtgagcctagcacactgaaccatca |
38865761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 107 - 152
Target Start/End: Original strand, 22654244 - 22654289
Alignment:
| Q |
107 |
tgcccgctccaagttgagagttgggccatgggatttgggtgaaggc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
22654244 |
tgcccgctccaagttgagagttgggccacgggatttgggcgaaggc |
22654289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 107 - 152
Target Start/End: Complemental strand, 37328254 - 37328209
Alignment:
| Q |
107 |
tgcccgctccaagttgagagttgggccatgggatttgggtgaaggc |
152 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
37328254 |
tgccctctccaagttgagagttgggccacgggatttgggcgaaggc |
37328209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 196
Target Start/End: Original strand, 31268165 - 31268247
Alignment:
| Q |
114 |
tccaagttgagagttgggccatgggatttgggtgaaggctcaggtctcctggtcattagaatggagggatccgcatgaggttg |
196 |
Q |
| |
|
||||||||||||||||||| |||| ||||| | |||||| || |||| || ||| ||||||||||||||| ||||||||||| |
|
|
| T |
31268165 |
tccaagttgagagttgggctatggaatttgagcgaaggcccaaatctcatgatcactagaatggagggatctgcatgaggttg |
31268247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0754 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0754
Description:
Target: scaffold0754; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 3821 - 3875
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
3821 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
3875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0563
Description:
Target: scaffold0563; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 671 - 725
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
671 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 10353 - 10407
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
10353 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
10407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Complemental strand, 130 - 76
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
130 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
76 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 713 - 767
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
713 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Complemental strand, 15830102 - 15830048
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
15830102 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
15830048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Complemental strand, 15831830 - 15831776
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
15831830 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
15831776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 151
Target Start/End: Complemental strand, 15833557 - 15833503
Alignment:
| Q |
98 |
tatgctggc-tgcccgctccaagttgagagttgggccatgggatttgggtgaagg |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
15833557 |
tatgctggcctgcccgctccaagttgagagttgtgccacgggacatgggtgaagg |
15833503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 106 - 134
Target Start/End: Complemental strand, 46627299 - 46627271
Alignment:
| Q |
106 |
ctgcccgctccaagttgagagttgggcca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46627299 |
ctgcccgctccaagttgagagttgggcca |
46627271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University