View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1012_low_3 (Length: 330)
Name: NF1012_low_3
Description: NF1012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1012_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 100 - 279
Target Start/End: Original strand, 19082388 - 19082567
Alignment:
| Q |
100 |
gaattggcatagttacacttaaagcaagatttttatgtttctagtttttcaagctttatgatttttctctgcaaataagtttgtggcttattttttatga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19082388 |
gaattggcatagttacacttaaagcaagattttaatgtttctagtttttcaagctttatgatttttctctgcaaataagtttgtggcttattttttatga |
19082487 |
T |
|
| Q |
200 |
cctgtaannnnnnngaataatacgttgaatcacgatgacattacattattaatttaccacataatcaaatataattccac |
279 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19082488 |
cgtgtaaattttttgaataatacgttgaatcacgatgacattacattattaatttaccacataatcaaatataattccac |
19082567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University