View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1012_low_7 (Length: 275)
Name: NF1012_low_7
Description: NF1012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1012_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 269
Target Start/End: Original strand, 11346171 - 11346410
Alignment:
Q |
30 |
aacttgctgaagtcaaggaagaacataagcaacagaaagcaattcaagaagctcagattaaaaagacagaggatctggaaatgactgtgaagcaacaatt |
129 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
T |
11346171 |
aacttgctgaagtcaaggaagaacagaagcaacagaaagcaattcaagaagctcagattaaaaagacaaaggatctggaaatgattgtgaagcaacaatt |
11346270 |
T |
 |
Q |
130 |
cgaagagattaagtctgagattgcctcttttcttaagatgatgcagcagnnnnnnnnnnnnnnnnnttagaatgcacaccttgtgtttatttattgttgt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
11346271 |
tgaagagattaagtctgagattgcctcttttcttaagatgacgcagcaacaacaagaacaacaaccttagaatgcacaccttgtgtttatttattgttgt |
11346370 |
T |
 |
Q |
230 |
ttacattatgcctctgaaacttatgtgttgcctatgatac |
269 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
11346371 |
ttacattatgcctctgaaacttatgtgttgtctatgatac |
11346410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University