View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1012_low_9 (Length: 227)
Name: NF1012_low_9
Description: NF1012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1012_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 35762321 - 35762451
Alignment:
| Q |
1 |
cattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctgtgnnnnnnnaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35762321 |
cattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctgtgtttttttaa |
35762420 |
T |
|
| Q |
101 |
cagcataatttttgttgttgtttggtctctg |
131 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
35762421 |
cagcataatttttgttgttgtttggtttctg |
35762451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University