View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_11 (Length: 255)
Name: NF10130_low_11
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 21 - 255
Target Start/End: Original strand, 2488366 - 2488600
Alignment:
| Q |
21 |
cacagatttcagcatcagcacataaacgtgttttggatagtaaggctatacatctcaacaaaagacattgatttgatgattggaaaattcacttgcaggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488366 |
cacagatttcagcatcagcacataaatgtgttttggatagtaaggctatacatctcaacaaaagacattgatttgatgattggaaaattcacttgcaggt |
2488465 |
T |
 |
| Q |
121 |
tctactttatgtgtcaaagacctatcccattgttctatatctgcgggatgctgataagttgttgtgtagatcacaaaggatatataaactattgcagaca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2488466 |
tctactttatgtgtcaaagacctatcccattgttctatatatgcgggatgctgataagttgttgtgtagatcacaaaggatatataaactattccagaca |
2488565 |
T |
 |
| Q |
221 |
atgttaacgagactatctggaccaattttgattat |
255 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
2488566 |
atgttaacgaaactatctggaccaattttgattat |
2488600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 81 - 253
Target Start/End: Complemental strand, 41592747 - 41592575
Alignment:
| Q |
81 |
aaagacattgatttgatgattggaaaattcacttgcaggttctactttatgtgtcaaagacctatcccattgttctatatctgcgggatgctgataagtt |
180 |
Q |
| |
|
|||||||| |||||| | |||||| || |||||||||||||||||| ||||||||| || ||||||||||| ||||||||| |||||| ||||| ||| |
|
|
| T |
41592747 |
aaagacatggatttggtaattggacgttttacttgcaggttctactttctgtgtcaaaaacttatcccattgtgctatatctgagggatgttgataggtt |
41592648 |
T |
 |
| Q |
181 |
gttgtgtagatcacaaaggatatataaactattgcagacaatgttaacgagactatctggaccaattttgatt |
253 |
Q |
| |
|
|| | ||||||||||| ||||||||| | || || | |||||| | |||||| |||||||| ||| ||||| |
|
|
| T |
41592647 |
attatctagatcacaaaagatatataacatgttccaaaaaatgttgaagagactctctggaccgattctgatt |
41592575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University