View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_12 (Length: 250)
Name: NF10130_low_12
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 24 - 240
Target Start/End: Original strand, 10028236 - 10028452
Alignment:
| Q |
24 |
tccttaatggttattgatttgaattaatgttactagacatatcattgacgatctattacttctggctggtgtttcaggctttccaaaatcattttctttc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10028236 |
tccttaatggttattgatttgaattaatgttactagacatatcattgacgatctattacttctggctggtgtttcaggctttccaaaatcattttctttc |
10028335 |
T |
 |
| Q |
124 |
attacaaatatcttatttaatacactaatgtttatcctcagaaactgagaaaagggaacacttgaactaaaatgttatggatttttatatcgtttatata |
223 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10028336 |
tttacaaatatcttattttatacactaatgtttatcctcagaaactgagaaaagggaacacttgaactaaaatgttacggatttttatatcgtttatata |
10028435 |
T |
 |
| Q |
224 |
tctttccctatgcttct |
240 |
Q |
| |
|
|||||| || ||||||| |
|
|
| T |
10028436 |
tctttctctgtgcttct |
10028452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 151 - 240
Target Start/End: Original strand, 10050276 - 10050365
Alignment:
| Q |
151 |
atgtttatcctcagaaactgagaaaagggaacacttgaactaaaatgttatggatttttatatcgtttatatatctttccctatgcttct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
10050276 |
atgtttatcctcagaaactgagaaaagggaacacttgaactaaaatgttacggatttttatatcgtttatatatctttctctgtgcttct |
10050365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Original strand, 10062345 - 10062381
Alignment:
| Q |
178 |
ggaacacttgaactaaaatgttatggatttttatatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |
|
|
| T |
10062345 |
ggaacacttgaactaaaatgttatggacttctatatc |
10062381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University