View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_13 (Length: 244)
Name: NF10130_low_13
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 46577472 - 46577248
Alignment:
| Q |
1 |
ttttgcgttattgtagctttgcgtggggctgcaacattgaaagcgagggcattgaaagaagtttggaatattgcagcagtgattcctgtggagagaaatt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46577472 |
ttttgtgttattgtagctttgcgtggggctgcaacattgaaagcgagggcattgaaagaagtttggaatattgcagcagtgattcctgtggagagaaatt |
46577373 |
T |
|
| Q |
101 |
tgggggcttctggtggtaatggtaatggaagttcccatagtagcttcagcggtgagcttgtaccggaagatattttctcgggtactatctatagtagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46577372 |
tgggggcttctggtggtaatggtaatggaagttcccatagtagcttcagcggtgagcttgtacctgaagatattttctcgggtactatctatagtagaga |
46577273 |
T |
|
| Q |
201 |
attacttgcaagaggttgtgagctt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46577272 |
attacttgcaagaggttgtgagctt |
46577248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 103
Target Start/End: Complemental strand, 15452884 - 15452794
Alignment:
| Q |
13 |
gtagctttgcgtggggctgcaacattgaaagcgagggcattgaaagaagtttggaatattgcagcagtgattcctgtggagagaaatttgg |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| | ||||||||||||| |||||| || || ||||||||||||| ||||||| |
|
|
| T |
15452884 |
gtagcattgcgtggggctgcaacattgaaagcaagggcccttaaagaagtttggagtattgctgctgtaattcctgtggagaagaatttgg |
15452794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University