View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_15 (Length: 229)
Name: NF10130_low_15
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 93 - 209
Target Start/End: Original strand, 29932716 - 29932832
Alignment:
| Q |
93 |
tattatgtggaaattcataagttcaattttctgatttaaggtttctaatgttaggccaagggtgatatcagatatgatgatttccagaaaaatgagcagt |
192 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29932716 |
tattatgtggaaattcataagtttaattttctgatttaaggtttctaatgttaggccaagggtgatatcagatatgatgatttccagaaaaatgagcagt |
29932815 |
T |
 |
| Q |
193 |
tgaatccgatgacgaaa |
209 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29932816 |
tgaatccgatgacgaaa |
29932832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 29931202 - 29931291
Alignment:
| Q |
1 |
tttccacaagcatttgaaattgtgtgttgtctaatttttgttcactgattctaaaatcaaaagcacttttgtacaatttgctgcattatc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29931202 |
tttccacaagcatttgaaattgtgtgttgtctaatttttgttcactgattctaaaatcaaaagcatttttgtacaatttgctgcattatc |
29931291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University