View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_3 (Length: 422)
Name: NF10130_low_3
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 46577891 - 46577590
Alignment:
| Q |
1 |
tgctcaggttcatgctgcggtatccgtggctgctgttgctgccgcagtagctgcgattgctgcggccatggccgcttcgtctgggtctggaaaagatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
46577891 |
tgctcaggttcatgctgcggtatccgtggctgctgttgctgccgcagtagctgcgattgctgcggccacggccgcctcgtctgggtctggaaaagatgag |
46577792 |
T |
|
| Q |
101 |
gagaaagcgagtactgactcggctgtggcttctgcagcgacgttggtggcggctcagtgtgttgagacggccgaggcgttgggggcagaaagggaacatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46577791 |
gagaaagcgagtactgactcggctgtggcttctgcagcgacgttggtggcggctcagtgtgttgagacggccgaggcgttgggggcagaaagggaacatc |
46577692 |
T |
|
| Q |
201 |
ttgctgctgtggttagctccgccgtgaatgttagatctgctggtgatatcatgactttaactgctgctgctgcaacaggtatatgtgattgtgatttatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46577691 |
ttgctgctgtggttagctccgccgtgaatgttagatctgctggtgatatcatgactttaactgctgctgctgcaacaggtatatgtgattgtgatttatg |
46577592 |
T |
|
| Q |
301 |
at |
302 |
Q |
| |
|
|| |
|
|
| T |
46577591 |
at |
46577590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University