View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_6 (Length: 326)
Name: NF10130_low_6
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 46153730 - 46153632
Alignment:
| Q |
16 |
tttaccactaaactgaaccttagagnnnnnnnnncttcctttccttacaaccattttcttgttccgtgtatatttgtgagccctaaacacataaaataa |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46153730 |
tttaccactaaactgaaccttagagtttttttttcttcctttccttacaaccattttcttgttccgtgtatatttgtgagccctaaacacataaaataa |
46153632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University