View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10130_low_7 (Length: 325)
Name: NF10130_low_7
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10130_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 32452700 - 32452842
Alignment:
| Q |
14 |
atcttcatcatataatctcttttgctatacacattatagctctgtttggtttggattttggctatgccaaccagtattacaagcctcatttatttagaca |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32452700 |
atcttcatcatataatctcttctgctatacaaattatagctctgtttggtttggattttggctatgccaaccagtattacaagcctcatttatgtagaca |
32452799 |
T |
 |
| Q |
114 |
ttctacatgtcaatcaatggacaatgttttacatggagaatat |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32452800 |
ttctacatgtcaatcaatggacaatgttttacatggagaatat |
32452842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 248 - 314
Target Start/End: Complemental strand, 3260849 - 3260783
Alignment:
| Q |
248 |
tatagtattgtaactgtctttctcaatttaaaatttattttttcagtcttcttaattagtatctctg |
314 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| ||| || ||||||||| |||||||||| |
|
|
| T |
3260849 |
tatagtattataaatgtctttctcaatttaaaatttatatttgcaatcttcttaacgagtatctctg |
3260783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University