View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_high_28 (Length: 250)
Name: NF10131_high_28
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10131_high_28 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 32822395 - 32822635
Alignment:
Q |
10 |
gcagagatttgaggaaccgtttaggcctaaagaacaaacaaagcttgtgcagtgaaaccttagtaactcgtttccgtctgctatgcagcggggatgnnnn |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32822395 |
gcagagatttgaggaaccgtttaggcctaaagaacaaacaaaggttgtgcagtgaaaccttagtaactcgtttccgtctgctatgcagcggggatgtttt |
32822494 |
T |
 |
Q |
110 |
nnngagagatttgttgcttttgctttgattgagtctctgtactcttcgaacttggttatggttttctgtgtgttctggactttaaggatgcggtcgattt |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32822495 |
tttgagagatttgttgcttttgctttgattgagtctctgtactcttcgaacttggttatggttttctgtgtgttctggactttaaggatgcggtcgattt |
32822594 |
T |
 |
Q |
210 |
tacagacgggagattgcttctttagccagcttgagtgaaat |
250 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32822595 |
tacagacgggagattgcttctttagccagcttgagtgaaat |
32822635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University