View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_high_29 (Length: 250)
Name: NF10131_high_29
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10131_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 35697314 - 35697553
Alignment:
Q |
1 |
ctttggaacagcattagggtgtgagatttcaataacttgtggagggggtaaccataagaagagtggtagcactaataagcctcgtgttgctgactctgaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35697314 |
ctttggaacagcattagggtgtgagatttcgataacttgcggagggggtaaccataagaagagtggtagcactaataaacctcgtgttgctgactctgaa |
35697413 |
T |
 |
Q |
101 |
ctaacttatgaatcgtcttatatttgatgaggtgcttgttgtaaaattaattggtaattttaatggttgtgatgcatatatagtttggattagaaataga |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
T |
35697414 |
ctaacttatgaatcgtcttatatttgatgaggtgcttgttgtaaaattaattggtaatttttatggttgtgattcatatatagtttggattagaaataga |
35697513 |
T |
 |
Q |
201 |
aatttgattcatttggggatgttgagtattgtctcctttg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35697514 |
aatttgattcatttggggatgttgagtattgtctcctttg |
35697553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University