View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_high_30 (Length: 250)
Name: NF10131_high_30
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 48392772 - 48392533
Alignment:
| Q |
1 |
aagagtcaagatcttccatatcaacgagaagatatttgggattatggagaagactttctctgtaagggaagacattgttaccggtttcgaagttacggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392772 |
aagagtcaagatcttccatatcaacgagaagatatttgggattatggaggagactttctctgtaagggaagacattgttaccggtttcgaagttacggat |
48392673 |
T |
 |
| Q |
101 |
gaattctttgaatttttgaagaatggtgtggttggagatggtggcgtcggtttcgccgccgcggccgtcgtcccatgagtgtgcttggtcgctatagtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392672 |
gaattctttgaatttttgaagaatggtgtggttggagatggcggcgtcggtttcgccgccgcggccgtcgtcccatgagtgtgcttggtcgctatagtat |
48392573 |
T |
 |
| Q |
201 |
acgcctccttcgtcccaacctgacattgtttagatctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392572 |
acgcctccttcgtcccaacctgacattgtttagatctctg |
48392533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University