View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_high_47 (Length: 218)
Name: NF10131_high_47
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 54847953 - 54848164
Alignment:
| Q |
1 |
ttaacaattgtattttataatttttctcttaagctgaacaaatggaacaagaaatcgaaaacatgatattcaacatgagttcacttggaacaagtttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54847953 |
ttaacaattgtattttataatttttctcttaagctgaacaaatggaagaagaaatcgaaaacatgatattcaacatgagttcacttggaacaagtttctc |
54848052 |
T |
 |
| Q |
101 |
acaaaagtaagagcatttaattgtttgt------------ttaattaattttgcttgattaaattttgtgttatatgtatgagcaggagaggaggattat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54848053 |
acaaaagtaagagcatttaattgtttgtttaattaattaattaattaattttgcttgattaaattttgtgttatatgtatgagcaggagaggaggattat |
54848152 |
T |
 |
| Q |
189 |
caaggtattact |
200 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54848153 |
caaggtattact |
54848164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University