View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_high_49 (Length: 211)
Name: NF10131_high_49
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10131_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 34097885 - 34098067
Alignment:
Q |
20 |
gctgcctgtggcaaacatgctatatctctttgttctacttattatgaccacctttttaccttttaacttttctgtaatctctcttctttaggtaaaactg |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34097885 |
gctgcctgtggcaaacatgctatatctctttgttctacttattatgaccacctttttaccttttaacttttctgtaatctctcttctttaggtaaaactg |
34097984 |
T |
 |
Q |
120 |
caccctaatatctctccctatgttctcttttcttactcacagttcaaacataggactacatcacaattcttttcttctctctc |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34097985 |
caccctaatatctctccctatgttctcttttcttactcacagttcaaacataggactacatcacaattcttttcttctctctc |
34098067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University