View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_15 (Length: 401)
Name: NF10131_low_15
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 5e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 278 - 393
Target Start/End: Complemental strand, 13084750 - 13084637
Alignment:
| Q |
278 |
aactttttgtatttttggtgtgatacaagagtggtaggacagcagaagaacatgacatccttcctgatggatacgtagtaaataagggggagacagtgta |
377 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
13084750 |
aactttttgtatttttggtgtgagac--gagtggtaggacagcagaagaacatgacatccttcctgatggctacaaagtaaataagggggaaacagtgta |
13084653 |
T |
|
| Q |
378 |
ttacttgtcctatgct |
393 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
13084652 |
ttacttgtcttatgct |
13084637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 295 - 393
Target Start/End: Complemental strand, 13077813 - 13077715
Alignment:
| Q |
295 |
gtgtgatacaagagtggtaggacagcagaagaacatgacatccttcctgatggatacgtagtaaataagggggagacagtgtattacttgtcctatgct |
393 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
13077813 |
gtgtgatacaagtctggtaggacagcagaagaacatgacatccttcctgatggatacatagtgaataagggggagacagtttactacttgtcctatgct |
13077715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University