View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_22 (Length: 362)
Name: NF10131_low_22
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_22 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 22 - 346
Target Start/End: Original strand, 42596 - 42920
Alignment:
| Q |
22 |
ctggtcaaatttaacttcacagggatgaatatgacagatgatgctatagctatgctaattatttatcaaccaaaaggactagctctctgacaccattctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42596 |
ctggtcaaatttaacttcacagggatgaatatgacagatgatactatagctatgctaattatttatcaaccaaaaggactagctctctgacaccattctt |
42695 |
T |
 |
| Q |
122 |
actacttcatcagaacatgaaaactacaatagactgatcactgctaagtttttaacagtatcatttacaaatattaatgttccatcttaattaatgacca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42696 |
actacttcatcagaacatgaaaactacaatagactgatcactgctaagtttttaacagtatcatttacaaatattaatgttccatcttaattaatgacca |
42795 |
T |
 |
| Q |
222 |
aatttggcaaagttgacaaaccaaacttcagaactatgaattaacttttgattaaagaaaggaatttacagtagattatcactgctctcaattgctgaaa |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42796 |
aatttggcaaagttgacaaaccaaacttcagaactatgaattaacttttgattaaagaaaggaatttacagtagattatcactgctcccaattgctgaaa |
42895 |
T |
 |
| Q |
322 |
acattgtactcttcaattcattgat |
346 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42896 |
acattgtactcttcaattcattgat |
42920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University