View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_24 (Length: 352)
Name: NF10131_low_24
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 111 - 337
Target Start/End: Original strand, 34008036 - 34008262
Alignment:
| Q |
111 |
catattatggtgtgtattgtttttctttttagtaattagaagtggcatttcttcttgtttacacagttgtgtttgatttaattgatggatgaaatgccag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34008036 |
catattatggtgtgtattgtttttctttttagtaattagaagtggcatttcttcttgtttacacagttgtgtttgatttaattgatggatgaaatgccag |
34008135 |
T |
|
| Q |
211 |
gtttgttgtagaaacggtgtgagttccaataacttatatatgcactcttcttattaattaaatcctttgtttaaattatgcagtttatcacttttcaagc |
310 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34008136 |
gtatgttgtagagacggtgtgagttccaataacttatatatgtactcttcttattaattaaatcctttgtttaaattatgcagtttatcacttttcaagc |
34008235 |
T |
|
| Q |
311 |
tcaagctaactagtagtaactgtgatg |
337 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
34008236 |
tcaaactaactagtagtaactgtgatg |
34008262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 104 - 222
Target Start/End: Complemental strand, 33349718 - 33349601
Alignment:
| Q |
104 |
catgcttcatattatggtgtgtattgtttttctttttagtaattagaagtggcatttcttcttgtttacacagttgtgtttgatttaattgatggatgaa |
203 |
Q |
| |
|
||||||||||||| ||||||||||| || |||||| ||||||||| ||| ||||||||| ||| || |||||| |||||| ||||| | ||||||| | |
|
|
| T |
33349718 |
catgcttcatattgtggtgtgtatttttgttctttcgagtaattaggagttgcatttcttggtgtatatacagttctgtttgctttaa-tcatggatgca |
33349620 |
T |
|
| Q |
204 |
atgccaggtttgttgtaga |
222 |
Q |
| |
|
|| ||||| ||||||||| |
|
|
| T |
33349619 |
attgcaggtatgttgtaga |
33349601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University