View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_28 (Length: 333)
Name: NF10131_low_28
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 10119935 - 10120109
Alignment:
| Q |
15 |
actactttcctttactcctactactccacgttttgccattctttttgttattatatataaataatctcattcaattaagacaacacaagaaaccaacgtt |
114 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10119935 |
actactttcctttactcccactactccacgttttgccattctttttgttgttatatataaataatctcattcaattaagacaacacaagaaactaacgtt |
10120034 |
T |
 |
| Q |
115 |
atacatgacacatactcacatgctaatgttacaactgcaaccaagattctgcttctaacttctaattaatcatca |
189 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10120035 |
atacatgacacataatcacatgctaatgttacaactgcaaccaagattctgcttctaacttctaattaatcatca |
10120109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 253 - 330
Target Start/End: Original strand, 10120173 - 10120250
Alignment:
| Q |
253 |
aacaatgtcttctttaagataccatatctttaatctgcttcttgcagtacttgttgcaaattctggcctttgcttctc |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
10120173 |
aacaatgtcttctttaagataccatatctttaatctgcttcttgcagtacttgttgcaaattctggctttggcttctc |
10120250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University