View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_30 (Length: 317)
Name: NF10131_low_30
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 18 - 173
Target Start/End: Original strand, 10119954 - 10120109
Alignment:
| Q |
18 |
actactccacgttttgccattctttttgttattatatataaataatctcattcaattaagacaacacaagaaaccaacgttatacatgacacatactcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10119954 |
actactccacgttttgccattctttttgttgttatatataaataatctcattcaattaagacaacacaagaaactaacgttatacatgacacataatcac |
10120053 |
T |
 |
| Q |
118 |
atgctaatgttacaactgcaaccaagattctgcttctaacttctaattaatcatca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10120054 |
atgctaatgttacaactgcaaccaagattctgcttctaacttctaattaatcatca |
10120109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 237 - 314
Target Start/End: Original strand, 10120173 - 10120250
Alignment:
| Q |
237 |
aacaatgtcttctttaagataccatatctttaatctgcttcttgcagtacttgttgcaaattctggcctttgcttctc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
10120173 |
aacaatgtcttctttaagataccatatctttaatctgcttcttgcagtacttgttgcaaattctggctttggcttctc |
10120250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University