View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_42 (Length: 269)
Name: NF10131_low_42
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 41878822 - 41878576
Alignment:
| Q |
8 |
gacgttggacaccgttgttgatgagtttcttctccacatgtttgattgtgtctatgttgtgtgtgttgagttctgttttttcaactctcttttttccttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41878822 |
gacgttggacaccgttgttgatgagtttcttctccacatgtttgattgtgtctatgttgtgtgtgtttagttctgttttttcaactctcttttttccttc |
41878723 |
T |
 |
| Q |
108 |
ttcgtcgtgactcactgctcttattgttaccgtctcttgtttctcgtcgattggcttcattgttgcttgctacaaagaaag-ttatttatgtttatgatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41878722 |
ttcgtcgtgactcactgctcttattgttaccgtctcttgtttctcgtcgattggcttcattgctgcttgctacaaagaaagtttatttatgtttatgatg |
41878623 |
T |
 |
| Q |
207 |
tatgtcataaaatacaaagtgtaaggtggtttttatttataggaggt |
253 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41878622 |
tatgttatacaatacaaagtgcaaggtggtttttatttataggaggt |
41878576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University