View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_44 (Length: 268)
Name: NF10131_low_44
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 251
Target Start/End: Complemental strand, 40497650 - 40497414
Alignment:
| Q |
15 |
atgaagagggtgttgtatttgttgaagctgaagcgaactgtatggtggaggatttgagtgatgtgaaggagcctgaccttgatattcttagaaaactagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40497650 |
atgaagagggtgttgtatttgttgaagctgaagcgaactgtatggtggaggatttgagtgatgtgaaggagcctgaccttgatattcttagaaaactagt |
40497551 |
T |
 |
| Q |
115 |
ttatgacattcctactgcaaagaacttactagagatgcctccacttctaattcaggtttttgtttatatttacattgtcatgaaattcgatgtttgttaa |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40497550 |
ttatgacatccctactgcaaagaacttactagagatgcctccacttctaattcaggtttttgtttatatttacattgtcatgaaatttgatgtttgttaa |
40497451 |
T |
 |
| Q |
215 |
attaaagaactcttgttaaagaacttactgacttatt |
251 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40497450 |
attaaagaactcttgttaaagaactcactgacttatt |
40497414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University