View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_47 (Length: 257)
Name: NF10131_low_47
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_47 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 257
Target Start/End: Complemental strand, 52832596 - 52832352
Alignment:
| Q |
13 |
agaaacagaggaaactccgaattttattgtccactttccttacattgttaaacaaaggtcacatgtaacatcgccacacttgttacttcttttccctttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| | |||| |||||||||||||||||||||| |
|
|
| T |
52832596 |
agaaacagaggaaactccgaattttattgtccactttccctacattgttaaacaaaggtcgcatgtaacaccaccacccttgttacttcttttccctttt |
52832497 |
T |
 |
| Q |
113 |
tgcacccatttatgattgattatacacccttctcttgtagcagaaattaaagaacccaactcctccacattgtagtaacatacattttcggaatggcgag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52832496 |
tgcacccatttatgattgattatacacccttctcttgtagcagaaattaaagaacccaactcctccacattgtagtaacatacattttcggaatggcgag |
52832397 |
T |
 |
| Q |
213 |
gaaaaattattcaccatcttcatctgcattgcgttatgttcaacc |
257 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52832396 |
gaaaaattattcatcatcttcatctgcattgcgttatgttcaacc |
52832352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University