View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_53 (Length: 250)
Name: NF10131_low_53
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41611783 - 41611547
Alignment:
| Q |
1 |
atattgtcttatcaacttaaaatcgctggatgcgttactgcaggtactcgttatggcatatcatttccggttcttgctagatcatcttttggcatccatg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41611783 |
atattgtcttgtcaacttaaaatcgctggatgcgttactgcaggtacgcgttatggcatatcatttccggttcttgctagatcatcttttggcatccatg |
41611684 |
T |
 |
| Q |
101 |
gtgctcacattcccacccttttaagggccttagttggttgtggttggtatggaattgaaacatggattggtggagagacaattttccttcttttgccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41611683 |
gtgctcacattcccacccttttaagggccttagttggttgtggttggtatggaattgaaacatggattggtggagagacaattttccttcttttgccaaa |
41611584 |
T |
 |
| Q |
201 |
ttcaataaaacaaagtacattgtcaaaatctctacct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41611583 |
ttcaataaaacaaagtacattgtcaaaatctctacct |
41611547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 52 - 221
Target Start/End: Original strand, 27112105 - 27112274
Alignment:
| Q |
52 |
tatggcatatcatttccggttcttgctagatcatcttttggcatccatggtgctcacattcccacccttttaagggccttagttggttgtggttggtatg |
151 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||||||| || ||||||||||||||||| || ||| |||| || |||||||||||||||||||||| |
|
|
| T |
27112105 |
tatggcatatcattcccagttcttgctagatcctcttttggtattcatggtgctcacattccaactcttctaagagctttagttggttgtggttggtatg |
27112204 |
T |
 |
| Q |
152 |
gaattgaaacatggattggtggagagacaattttccttcttttgccaaattcaataaaacaaagtacatt |
221 |
Q |
| |
|
|||||||| |||||||||| || || |||||||| || | | ||||||||| ||||| ||| |||||| |
|
|
| T |
27112205 |
gaattgaatcatggattgggggtgaagcaattttcattttactaccaaattcactaaaagaaattacatt |
27112274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University