View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_63 (Length: 242)
Name: NF10131_low_63
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10131_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 2920445 - 2920669
Alignment:
Q |
1 |
tgttttttcatcgaattatatgaattttgcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgaatgggaatgaggcacgata |
100 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
T |
2920445 |
tgttttttcatcgaattacatgaattttgcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgagtgggaacgaggcacgata |
2920544 |
T |
 |
Q |
101 |
ttcaaccgggttgttctctatcccgaaaggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgat |
200 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2920545 |
ttcaaccgggctgttctctatcccgaaaggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgat |
2920644 |
T |
 |
Q |
201 |
catgttgaattcctcaagtattatt |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
2920645 |
catgttgaattcctcaagtattatt |
2920669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 2935315 - 2935516
Alignment:
Q |
23 |
aattttgcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgaatgggaatgaggcacgatattcaaccgggttgttctctatc |
122 |
Q |
|
|
||||||| |||||||||||||||||||| |||||||||| ||||| |||||||||||| ||||||||||||| |||||||| | ||||||||||||| | |
|
|
T |
2935315 |
aattttgtaggcatggtcaaacgggaggttgcattcgccatttcacagggtgatgatgagtgggaatgaggcaagatattcagcagggttgttctctacc |
2935414 |
T |
 |
Q |
123 |
ccgaaaggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaagtatt |
222 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||| ||||| |||||| | ||| ||||||||||||| |
|
|
T |
2935415 |
cccaaaggagggtacattataaaagctccggaggagctggtggacgaggagcaccctttgctctttaagccttttgatcaagctgagttcctcaagtatt |
2935514 |
T |
 |
Q |
223 |
at |
224 |
Q |
|
|
|| |
|
|
T |
2935515 |
at |
2935516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University