View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_68 (Length: 238)
Name: NF10131_low_68
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_68 |
 | |
|
| [»] scaffold0136 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0136 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 25509 - 25728
Alignment:
| Q |
1 |
aggtatgtgcaaactatcagcaatattaactccacaccaattatcagaccaaaatctgatatgctcaccattaccaagcaaccaagaggagttcactaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25509 |
aggtatgtgcaaactatcagcaatattaactccacaccaattatcagaccaaaatctgatatgctcaccattaccaagcaaccaagaggagttctctaga |
25608 |
T |
|
| Q |
101 |
atggtgggatactcatttttcatactactccatagagatgatgacacatgataagctattggttttcttcttttgataactttgtctttcaaagaagtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25609 |
atggtgggatactcatttttcatactactccatagagatgatgatacatgataagctattggttttcttcttttgataactttgtctttcaaagaagtgg |
25708 |
T |
|
| Q |
201 |
cccaaggctgattggaattt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25709 |
cccaaggctgattggaattt |
25728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University