View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_70 (Length: 236)
Name: NF10131_low_70
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 36759799 - 36759596
Alignment:
| Q |
15 |
caaagggtatatggttgggctagtacatgaatgtatgcgggtttagaaagaaaggaaaataatacacataataaagcttgaaaattaaaatttactgaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36759799 |
caaagggtatatggttgggctagtacatgaatgcatgcgggtttagaaagaaaggaaaataatacacataataaagcttgaaaattaaaatttactgaat |
36759700 |
T |
 |
| Q |
115 |
tacctgaggcagcaaaacaacatccaacagagatatagacctaaaattttatgatgcaaatgttaggaataatggttgtagttgatggatggtagtgaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36759699 |
tacctgaggcagcaaaacaacatccaacagagatatagacctaaaattttatgatgcaaatgttaggaataatggttgtagttgatggatggtagtgaaa |
36759600 |
T |
 |
| Q |
215 |
gagg |
218 |
Q |
| |
|
|||| |
|
|
| T |
36759599 |
gagg |
36759596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University