View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_74 (Length: 234)
Name: NF10131_low_74
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 48392753 - 48392867
Alignment:
| Q |
1 |
tatggaagatcttgccttttttgccccttatcttccctctaatctccgatctgctcccgccgatattcttcctctggtaatttcttctaaactccgatct |
100 |
Q |
| |
|
|||||||||||||| || ||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392753 |
tatggaagatcttgactcttttgaccctgatcttccctctaaactccgatctgctcccgccgatattcttcctctggtaatttcttctaaactccgatct |
48392852 |
T |
 |
| Q |
101 |
tcgtcggttgatgac |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48392853 |
tcgtcggttgatgac |
48392867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 48392927 - 48392971
Alignment:
| Q |
175 |
aaactgcggcggcgcaggttttggtgagtttgaagacgaaggttg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392927 |
aaactgcggcggcgcaggttttggtgagtttgaagacgaaggttg |
48392971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University