View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_77 (Length: 227)
Name: NF10131_low_77
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_77 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 54847899 - 54847660
Alignment:
| Q |
1 |
gggaagctggtgaatcaactaaatataaaattatggtatgagaggcacattccgttacttaagaaaatgattggattggattggatttagattcaataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54847899 |
gggaagctggtgaatcaactaaatataaaattatggtatgagaggcacattc-gttacttaagaaaatgattggattggattggatttagattcaataat |
54847801 |
T |
|
| Q |
101 |
taaatat----------------ggtaaaagagttgtatgttatcaccgcatccttgtctacacttactctcaatcattcaagagactactaatttcaga |
184 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54847800 |
taaatatgggaatggtgtttataggtaaaagagttgtatgttatcaccgcatccttgtctacactttctctcaatcattcaagagactactaatttcaga |
54847701 |
T |
|
| Q |
185 |
tg---aataaaaatatatgcaatgagcctccctttgcttct |
222 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54847700 |
tgaataataaaaatatatgcaatgagcctccctttgtttct |
54847660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University