View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_78 (Length: 227)
Name: NF10131_low_78
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 51221857 - 51221663
Alignment:
| Q |
18 |
acggtagtcgcttgctgtatggagtattgtacattcatacagagaagaggacatggacattttgtcttgctttgaatctgtttttctgcccctttaatga |
117 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51221857 |
acggtagtcgcttgctgtatgacg-agtgtacattcatacagagaagaggacatagacattttgtcttgctttgaatctgtttttctgcccctttaatga |
51221759 |
T |
|
| Q |
118 |
atgaataaacagaacatagaggtttttctctcactcttgaaagataacaatgatcaatcttaattg-tttacattgaaatagtacattagaaaaggg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
51221758 |
atgaataaacagaacatagaggtttttctctcactcttgaaagataacaat-ctctatcttaattgtttttcattaaaatagtacattagaaaaggg |
51221663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University