View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_79 (Length: 223)
Name: NF10131_low_79
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10131_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 313488 - 313296
Alignment:
| Q |
14 |
atgaaagaaaatgtcaacgttgggatggtaagctcatgcttgttttttgacttaacacaattgatgaaatgaaagcttagccaagcacaagaaaaacaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
313488 |
atgaaagaaaatgtcaacgttgggatggtaagctcatgattgttttttgacttaacacaattgatgaaatgaaagcttagccaagcacaagaaaaacaca |
313389 |
T |
|
| Q |
114 |
aagg-tctactctatctaaggggttttcacgcctgcttccttcacctttaacagtttcctcaaattgtcttttcatagtccgatccgagcttgtttt |
209 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
313388 |
aaggctctac----tctaaggggttttcacgcctgcttccttcacctttaacagtttcctcaaattgtcttttcatagtccgatccgagcttgtttt |
313296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University