View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10131_low_84 (Length: 209)
Name: NF10131_low_84
Description: NF10131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10131_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 65 - 193
Target Start/End: Complemental strand, 36489661 - 36489533
Alignment:
Q |
65 |
cggagtggcattctcctatcatatcggttgatgagcaagaagtgagtggtctattatctgtcatttgttgggttcatgacttgcacttggatggagtaat |
164 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36489661 |
cggagtgacattctcctatcatatcggttgatgagcaagaagtgagtggtctattatctgtcatttgttgggttcatgacttgcacttggatggagtaat |
36489562 |
T |
 |
Q |
165 |
tttcaaacttgattctaagcatgttgttg |
193 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
36489561 |
tttcaaacttgattctaagcatgttgttg |
36489533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University