View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10132_high_8 (Length: 207)

Name: NF10132_high_8
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10132_high_8
NF10132_high_8
[»] chr1 (3 HSPs)
chr1 (53-191)||(7502792-7502930)
chr1 (55-105)||(8139339-8139389)
chr1 (55-103)||(7499537-7499585)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 53 - 191
Target Start/End: Complemental strand, 7502930 - 7502792
Alignment:
53 actctttgttactgattgcatgcttggatatcactgtttttggaatgatgtctannnnnnnnagtcttgatcattcagtaatgtttcttatctgtaattt 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||    
7502930 actctttgttactgattgcatgcttggatatcactgtttttggaatgatgtctattttttttagtcttgatcattcagtaatgtttcttatctgtaattt 7502831  T
153 aattcaatactttgatatttctctcacgcctatcgaacc 191  Q
    ||||||||||||||||||||||||||||||| |||||||    
7502830 aattcaatactttgatatttctctcacgcctttcgaacc 7502792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 105
Target Start/End: Original strand, 8139339 - 8139389
Alignment:
55 tctttgttactgattgcatgcttggatatcactgtttttggaatgatgtct 105  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||    
8139339 tctttgttactgaatgcatgcttgaatatcactgtttttggaatgatgtct 8139389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 55 - 103
Target Start/End: Complemental strand, 7499585 - 7499537
Alignment:
55 tctttgttactgattgcatgcttggatatcactgtttttggaatgatgt 103  Q
    ||||||||||||| |||||||||| | ||||||||||||||||||||||    
7499585 tctttgttactgaatgcatgcttgaacatcactgtttttggaatgatgt 7499537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University