View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_high_8 (Length: 207)
Name: NF10132_high_8
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10132_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 53 - 191
Target Start/End: Complemental strand, 7502930 - 7502792
Alignment:
| Q |
53 |
actctttgttactgattgcatgcttggatatcactgtttttggaatgatgtctannnnnnnnagtcttgatcattcagtaatgtttcttatctgtaattt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502930 |
actctttgttactgattgcatgcttggatatcactgtttttggaatgatgtctattttttttagtcttgatcattcagtaatgtttcttatctgtaattt |
7502831 |
T |
 |
| Q |
153 |
aattcaatactttgatatttctctcacgcctatcgaacc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7502830 |
aattcaatactttgatatttctctcacgcctttcgaacc |
7502792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 105
Target Start/End: Original strand, 8139339 - 8139389
Alignment:
| Q |
55 |
tctttgttactgattgcatgcttggatatcactgtttttggaatgatgtct |
105 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8139339 |
tctttgttactgaatgcatgcttgaatatcactgtttttggaatgatgtct |
8139389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 55 - 103
Target Start/End: Complemental strand, 7499585 - 7499537
Alignment:
| Q |
55 |
tctttgttactgattgcatgcttggatatcactgtttttggaatgatgt |
103 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
7499585 |
tctttgttactgaatgcatgcttgaacatcactgtttttggaatgatgt |
7499537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University