View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_low_16 (Length: 351)
Name: NF10132_low_16
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10132_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 20 - 114
Target Start/End: Complemental strand, 8025914 - 8025820
Alignment:
| Q |
20 |
cttccaaccttacgttatttatgcttcctatgtcctcatcaaataccctccgtgtttccctagttaattggttcgaaatctatccgttaaagctt |
114 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8025914 |
cttccaaccttaggttatttatgcttcctatgtcctcatcaaataccctccgtgtttccctagttaattggttcgaaatctatccgttaaagctt |
8025820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 155 - 243
Target Start/End: Complemental strand, 8025828 - 8025739
Alignment:
| Q |
155 |
ttaaagcttactttcttttcc-tgcttcctcatgtttgatttttccatcatctgtgaacagtaatttctctgtggcgtgtaacactactg |
243 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8025828 |
ttaaagcttactttcttttccgtgcttcctcatgtttgatttttccatcatctgtcaacagtaatttctctgtggcgtgtaacactactg |
8025739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University