View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_low_21 (Length: 334)
Name: NF10132_low_21
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10132_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 324
Target Start/End: Original strand, 7290190 - 7290496
Alignment:
| Q |
18 |
gatatattggatattaaggattgtagtgtttctttaagagtatcagtaatcaatgattatattccttatattcttgatgcaagttgatgataatcgtctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7290190 |
gatatattggatattaaggattgtagtgtttctttaagagtatcagtaatcaatgattatattccttgtattcttgatgcaagttgatgataatcgtctt |
7290289 |
T |
 |
| Q |
118 |
ttggtatgttgggcagaattatgcacaaacatactttaggtaaaataaacttatcttttatgtcttgcatggtagtgccttcaaggtccaagttatggtt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7290290 |
ttggtatgtttggcagaattatgcacaaacatactttaggtaaaataaacttgtcttttatgccttgcatggtggtgccttcaaggtccaagttatggtt |
7290389 |
T |
 |
| Q |
218 |
gatgtaaggttacattacagtgctattttgatttatagggagtgacaaaccaaaaagttcattatatatagacataacaaatcacaatagaaaaatacgg |
317 |
Q |
| |
|
||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7290390 |
gatttaaggttacattacattattattttgatttatagggagtgacaaaccaaaaagttcattatatatagacataacaaatcacaatagaaaaatatgg |
7290489 |
T |
 |
| Q |
318 |
ccctttg |
324 |
Q |
| |
|
||||||| |
|
|
| T |
7290490 |
ccctttg |
7290496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University