View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_low_30 (Length: 260)
Name: NF10132_low_30
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10132_low_30 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 13271054 - 13271313
Alignment:
| Q |
1 |
cacattctctatgattgatctctgatggacatcagtatattcgctgaacatctcaaatcctcccatcatcatatagttgccaaattgttccaaaacattt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13271054 |
cacattctctatgattgacctctgatggacatcagtatattcactcgacatctcaaatgctcccatcatcatatagttgccaaattgttccaaaacaatt |
13271153 |
T |
|
| Q |
101 |
ccaccttcacttggtgtagcaagatgcaattcaagatattcttcaatttgctgcttattaacacttccaacattatcacttctttcaggtggcgatttca |
200 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271154 |
ccactttcagttggtgtagcaagattcaattcaagatattcttcaatttgctgcttattaacacttccaacattatcacttctttcaggtggcgatttca |
13271253 |
T |
|
| Q |
201 |
ttttgtacccttctccacctcgacccatcttttgcgaagatcttgacttcacatcactgc |
260 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13271254 |
ttttgtactcttctccacctcgacccgtcttttgcgaagatcttgacttcacatcactgc |
13271313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University