View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_low_38 (Length: 234)
Name: NF10132_low_38
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10132_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 40720249 - 40720451
Alignment:
| Q |
22 |
cccttaacagttgttctaagtccatgaccatctctatgattgggaaggggtcaatattaatattggacatttcttaaacttctttatcgcctaacttgaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
40720249 |
cccttaacagttgttctaagtccatgaccatctctatgactgggaaggggtcaatattaatattggacctttctgaaacttctttatcgcctaacttgaa |
40720348 |
T |
|
| Q |
122 |
cctatcttccttgatcaacttttaaacagctctttaaaagatgatgcaattagtcgtggtgtgattataggaattgtgccagttgacttatctcttgcct |
221 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40720349 |
cctgtcttccttgatcaacttttaaacagctctttaaaagatgatgcaattagtcgtggtgtgattataggaattgtgccagttgacttatctcttgcct |
40720448 |
T |
|
| Q |
222 |
ttg |
224 |
Q |
| |
|
||| |
|
|
| T |
40720449 |
ttg |
40720451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University