View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_low_39 (Length: 229)
Name: NF10132_low_39
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10132_low_39 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 34472378 - 34472604
Alignment:
Q |
3 |
attcatgttcatgcatgcatattctccggccggcaagtttttccttggctatattggactttcttcttctcatgcaagtaccacagttaggcgaggccgg |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34472378 |
attcatgttcatgcatgcatattctccggccggcaagtttttccttggctatattggactttcttcttctcatgcaagtaccacagttaggcgaggccgg |
34472477 |
T |
 |
Q |
103 |
tttaaccattgaatcaggaagtatttccctatctacgtatgagataattgcaactttgttgatgattatactaagccatagtaagttgtttggtttgaaa |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34472478 |
tttaaccattgaatcaggaagtatttccctatctacgtatgagataattgcaactttgttgatgattatactaagccatagtaagttgtttggtttgaaa |
34472577 |
T |
 |
Q |
203 |
aaatgtcttgttgttttctttttctat |
229 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
34472578 |
aaatgtcttgttgttttctttttctat |
34472604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University