View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10132_low_40 (Length: 229)
Name: NF10132_low_40
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10132_low_40 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 79 - 229
Target Start/End: Complemental strand, 2091901 - 2091751
Alignment:
Q |
79 |
tatgatcatgtgaaattttatgagtctaaatctatcaaccaaaaacttcattggttgcatacagaaactgaaggggttaaattgattcctgatgtattaa |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
2091901 |
tatgatcatgtgaaattttatgagtctaaatctatcaaccaaaaacttcattggttgcatacagaaactgaaggggttaaattgattcctgatatattaa |
2091802 |
T |
 |
Q |
179 |
ccttgatgatgcagagcttgtacaacttaaatgttaggaaaatggtggtca |
229 |
Q |
|
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
2091801 |
ccttgatgatacagaacttgtacaacttaaatgttaggaaaatggtggtca |
2091751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 2091948 - 2091918
Alignment:
Q |
7 |
agaaataaaggtaaaatacacctaaacttaa |
37 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2091948 |
agaaataaaggtaaaatacacctaaacttaa |
2091918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University