View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10132_low_40 (Length: 229)

Name: NF10132_low_40
Description: NF10132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10132_low_40
NF10132_low_40
[»] chr5 (2 HSPs)
chr5 (79-229)||(2091751-2091901)
chr5 (7-37)||(2091918-2091948)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 79 - 229
Target Start/End: Complemental strand, 2091901 - 2091751
Alignment:
79 tatgatcatgtgaaattttatgagtctaaatctatcaaccaaaaacttcattggttgcatacagaaactgaaggggttaaattgattcctgatgtattaa 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
2091901 tatgatcatgtgaaattttatgagtctaaatctatcaaccaaaaacttcattggttgcatacagaaactgaaggggttaaattgattcctgatatattaa 2091802  T
179 ccttgatgatgcagagcttgtacaacttaaatgttaggaaaatggtggtca 229  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||    
2091801 ccttgatgatacagaacttgtacaacttaaatgttaggaaaatggtggtca 2091751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 2091948 - 2091918
Alignment:
7 agaaataaaggtaaaatacacctaaacttaa 37  Q
    |||||||||||||||||||||||||||||||    
2091948 agaaataaaggtaaaatacacctaaacttaa 2091918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University