View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_high_7 (Length: 355)
Name: NF10133_high_7
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10133_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 11 - 106
Target Start/End: Original strand, 26562586 - 26562681
Alignment:
| Q |
11 |
gatggacatcaacaacagcagaaccaaacatgaatagcaacaggttccgtggaagatggagtaaacatgggtcagaatgatggacatgcatcacaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26562586 |
gatgaacatcaacaacagcagaaccaaacatgaatagcaacaggttccgtggaagatggagtaaacatgggtcagaatgatggacatgcatcacaa |
26562681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 343
Target Start/End: Original strand, 26562683 - 26562724
Alignment:
| Q |
302 |
atattgttcaattgttagatagagcgacactcacctatgcta |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26562683 |
atattgttcaattgttagatagagcgacactcacttatgcta |
26562724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 172
Target Start/End: Complemental strand, 3222396 - 3222360
Alignment:
| Q |
136 |
gcttttgtggcttatgaatttaggttttactcaagtg |
172 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3222396 |
gctttagtggcttatgaatttaggttttactcaagtg |
3222360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 99 - 167
Target Start/End: Complemental strand, 30780204 - 30780136
Alignment:
| Q |
99 |
catcacaagaagcagaagcatggggccaatggcaagcgcttttgtggcttatgaatttaggttttactc |
167 |
Q |
| |
|
|||| |||||||| ||||||| |||| | |||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
30780204 |
catctcaagaagcgaaagcatgtggcctaaagcaagcacttttgtggtttatgaattcaggttttactc |
30780136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University