View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_low_13 (Length: 359)
Name: NF10133_low_13
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10133_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 31589791 - 31590138
Alignment:
| Q |
1 |
cagactctcatcaggcagtgtccaggaaagcaaatgccctcctgaatccccacttaataactgcttcagatcgattgtgagatgaagagcagtaaccgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589791 |
cagactctcatcaggcagtgtccaggaaagcaaatgccctcctgaatccccacttaataactgcttcagatcgattgtgagatgaagagcagtaaccgga |
31589890 |
T |
|
| Q |
101 |
tgcttatggaacttgagtaccttgcgtaggatcaatctgtattctggctcttttgcaccaaggtttaacactctgaacccacctgcacctgatttgctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31589891 |
tgcttatggaacttgagtaccttgcgtaggatcaatctgtattctggctcttttgcaccaaggtttaacactctgaacccacttgcacctgatttgctga |
31589990 |
T |
|
| Q |
201 |
gagagctatctgggtcagagcagtgaaccatttgccacactttgacagcaccactctgatggcctgttgcgtaccactttgtttcctgccaatcagaaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589991 |
gagagctatctgggtcagagcagtgaaccatttgccacactttgacagcaccactctgatggcctgttgcgtaccactttgtttcctgccaatcagaaaa |
31590090 |
T |
|
| Q |
301 |
tctactgctcgtcactgagagaatagagtcagaaggcagttgtgatgt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31590091 |
tctactgctcgtcactgagagaatagagtcagaaggcagttgtgatgt |
31590138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University