View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_low_22 (Length: 307)
Name: NF10133_low_22
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10133_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 21 - 179
Target Start/End: Complemental strand, 43226723 - 43226565
Alignment:
| Q |
21 |
cggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggtttagaagatgagaaatgatcgaattttcaatgagaaggtgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || || ||||||||||||| |
|
|
| T |
43226723 |
cggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggtttagaagatgagaattgatcgcatatttaatgagaaggtgt |
43226624 |
T |
 |
| Q |
121 |
gtggagttgatgaaatggtggagcaagtcaaggtgattttgtggcattggagcttgagt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226623 |
gtggagttgatgaaatggtggagcaagtcaaggtgattttgtggcattggagcttgagt |
43226565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 214
Target Start/End: Complemental strand, 43226505 - 43226458
Alignment:
| Q |
167 |
ttggagcttgagtggttggtttacagttgcggcatttggtggtggtgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226505 |
ttggagcttgagtggttggtttacagttgcggcatttggtggtggtgg |
43226458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 272 - 307
Target Start/End: Complemental strand, 43226374 - 43226339
Alignment:
| Q |
272 |
ttttcctctgttttgcgcagagctgttattctctca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226374 |
ttttcctctgttttgcgcagagctgttattctctca |
43226339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 15623164 - 15623223
Alignment:
| Q |
22 |
ggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggttt |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |
|
|
| T |
15623164 |
ggtctaaaaagcttagacgaggggcgtggttaatttggcatgcggtcatttgggtggttt |
15623223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 15646953 - 15647012
Alignment:
| Q |
22 |
ggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggttt |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |
|
|
| T |
15646953 |
ggtctaaaaagcttagacgaggggcgtggttaatttggcatgcggtcatttgggtggttt |
15647012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 83 - 157
Target Start/End: Original strand, 16256768 - 16256842
Alignment:
| Q |
83 |
gaagatgagaaatgatcgaattttcaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgat |
157 |
Q |
| |
|
|||||||||||||||| | |||| ||| | || || ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
16256768 |
gaagatgagaaatgatagggtttttaataacaaagtttgtggggttgatgaaatggtggatcaagtcaaggtgat |
16256842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University