View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_low_28 (Length: 227)
Name: NF10133_low_28
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10133_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 5689799 - 5690007
Alignment:
Q |
1 |
tcactcttatttgcttttggtaaaagaaactgaggaggaagctagggtttcccttctttatagttataaacacactttcaatggttttgcagcattactt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5689799 |
tcactcttatttgcttttggtaaaagaaactgaggaggaagctagggtttcccttctttatagttataaacacactttcaatggttttgcagcattactt |
5689898 |
T |
 |
Q |
101 |
acaccaaatgaagccaataatctctcaggtaaagttatactactttgtaatttcatgttacaactcactagctacttgaaaattttatacacaacacaat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
5689899 |
acaccaaatgaagccaataatctctcaggtaaagttatactactttgtaatttcatgttacaactcactagctacttgaaaatttgatacacaacacaat |
5689998 |
T |
 |
Q |
201 |
agctagacc |
209 |
Q |
|
|
||||||||| |
|
|
T |
5689999 |
agctagacc |
5690007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 5680489 - 5680620
Alignment:
Q |
1 |
tcactcttatttgcttttggtaaaagaaactgaggaggaagctagggtttcccttctttatagttataaacacactttcaatggttttgcagcattactt |
100 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| |||||| ||||| ||||||||||||||||| ||||||||||||||| |
|
|
T |
5680489 |
tcactcttatttgcttttggtgaaagaaactgaggatgaagctcgagcttcccatctttacagttacaaacacactttcaatggctttgcagcattactt |
5680588 |
T |
 |
Q |
101 |
acaccaaatgaagccaataatctctcaggtaa |
132 |
Q |
|
|
||||| ||||||||||||||||| |||||||| |
|
|
T |
5680589 |
acacctaatgaagccaataatctttcaggtaa |
5680620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University