View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_low_30 (Length: 218)
Name: NF10133_low_30
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10133_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 166
Target Start/End: Complemental strand, 48518282 - 48518134
Alignment:
| Q |
18 |
aattatataaagaattgagagaacttagagagagtaaattgtagaatggattatctttattatttccttgatgaacaattacaatccttatgcaggccta |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48518282 |
aattatataaagaattgagagactttagagagagtaaattgtagaatggattatctttattatttccttgatgaacaattacaatccttatgtaggccta |
48518183 |
T |
 |
| Q |
118 |
acaattataactaattagtaacgtactaactaacttggttacattctgt |
166 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48518182 |
acaattatcactaactagtaacgtactaactaacttggttacattctgt |
48518134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University