View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_low_31 (Length: 201)
Name: NF10133_low_31
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10133_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 47838133 - 47837963
Alignment:
Q |
15 |
acatcataatttatacaacaaagggtgtataatttacaataggaatttgtcatttatcatcttggaacatgaatacttcacctgagctgggactgccttt |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47838133 |
acatcataatttatacaacaaagggtgtataatttacaataggaatttgtcatttatcatcttggaacatgaatacttcacctgagctgggactgccttt |
47838034 |
T |
 |
Q |
115 |
gccaattgggcaggtagttctgttatactagtaaacactgatagttgactgataatagacccggtaaaaac |
185 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47838033 |
gccaattgggcaggtagttctgttatactagtaaacactgatagttgactgataatagacccggtaaaaac |
47837963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University